Skip to content

Repository files navigation

Nanopore DNA storage

DNA storage for nanopore sequencing using convolutional coding and basecaller-decoder integration

Update: See bonito branch for improved performance and experiments using bonito basecalling and other improvements.

Code tested on Ubuntu 18.04.1 and Python3.

Download and install

Download:

git clone https://github.com/shubhamchandak94/nanopore_dna_storage/

Flappie models are stored using git lfs, see instructions in flappie/ directory README in case of issues.

Install:

./install.sh

Other than this, you might need to install the following Python3 packages: crc8, distance, fast5_research, h5py, numpy, scipy, scrappy, struct (see install_python_packages.sh). Also, flappie needs certain dependencies listed in the flappie/ directory.

General instructions

In many of the scripts, you need to set the path for the corresponding data directories as well as the encoding parameters. The current paths assume that the data is stored in ../nanopore_dna_storage_data/

Parameters for experiments

The file encode_experiments.py was used for generating the oligos and contains the parameters required for the decoding.

Convolutional code decoding of raw signal data

First, generate a list of read ids to decode using the script util/generate_read_ids.py (changing the parameters as needed). Then, run generate_decoded_lists.py with the relevant parameters. Below is an example execution for m=11, r=5/6 and list size 8.

python3 generate_decoded_lists.py \
--hdf_file ../nanopore_dna_storage_data/raw_signal/raw_signal_7.hdf5 \
--out_prefix ../nanopore_dna_storage_data/decoded_lists/exp_7/list \
--read_id_file ../nanopore_dna_storage_data/decoded_lists/exp_7/read_ids.txt \
--info_file ../nanopore_dna_storage_data/decoded_lists/exp_7/info.txt \
--mem_conv 11 \
--msg_len 180 \
--rate_conv 5 \
--list_size 8 \
--start_barcode CACCTGTGCTGCGTCAGGCTGTGTC \
--end_barcode GCTGTCCGTTCCGCATTGACACGGC

Note that the rate_conv parameter is set to 1, 2, 3, 4, 5 and 7 for convolutional code rates of 1/2, 2/3, 3/4, 4/5, 5/6 and 7/8, respectively. The msg_len parameter is the length of the binary input to the convolutional code encoder. This writes the decoded lists to files named list_1, list_2, ... in the directory ../nanopore_dna_storage_data/decoded_lists/exp_7/ and also generates an info.txt file listing the decoded reads. The parameters for the different experiments can be found in the files encode_experiments.py and logs/encoding_log.

Computing error rates of convolutional code decoding

To compute the number of errors (due to no CRC match being found and due to incorrect CRC match) from the decoded lists, use compute_error_rate_from_decoded_lists.py after setting the parameters.

Performing RS decoding of the lists

To perform RS decoding from the lists, use decode_RS_from_decoded_lists.py after setting the parameters. NUM_TRIALS denotes the number of decoding trials performed. Each trial involves a subsampling of NUM_READS_TO_USE reads from the set of decoded lists of size NUM_READS_TOTAL, an attempt at RS decoding and comparison with the original encoded file to ensure successful decoding.

Running simulations

The script simulator.py can be used to perform simulations to test various parameters for the convolutional code. The simulation of the raw signal is performed using the scrappie simulator with an optional mode to use dwell time distribution from DeepSimulator. An example execution is shown below:

python3 simulator.py \
--num_trials 100 \
--list_size 8 \
--mem_conv 11 \
--rate 5 \
--msg_len 180 \
--deepsimdwell False \
--reversecomp False \
--syn_sub_prob 0.004 \
--syn_del_prob 0.0085 \
--syn_ins_prob 0.0005

The mem_conv parameter can be set to 6, 8, 11 or 14. The rate parameter can be set to 1, 2, 3, 4, 5 and 7 for convolutional code rates of 1/2, 2/3, 3/4, 4/5, 5/6 and 7/8, respectively. The msg_len parameter decides the length of the binary input to the convolutional encoder, and should be set depending upon the desired oligo length. Setting deepsimdwell to True uses the dwell time distribution from DeepSim which has higher variance (based on our experience, keeping this False gives results closer to reality). reversecomp can be set to True to simulate reverse complemented read decoding. Finally, the parameters syn_sub_prob, syn_del_prob and syn_ins_prob decide the iid substitution, deletion and insertion error rates introduced during the synthesis.

About

DNA storage for nanopore sequencing using convolutional coding and basecaller-decoder integration

Topics

Resources

Stars

22 stars

Watchers

4 watching

Forks

Releases

Packages

Used by

Contributors

Languages