Custom Amplicon Panels Designer is a professional tool for amplicon sequencing technology, an ultra-high multiplex tiling PCR sequencing approach targeting DNA sequencing technology for Next-Generation Sequencing (NGS) and Nanopore sequencing (ONT).
The scope of this application is not limited to multiplex tiling PCR. Any sequence, of any length, and any number of target sequences can be used. There are no restrictions on the size of amplicons or their number, and standard PCR tasks for multiplex applications can be performed. In the target sequence, only the coordinates for analysis need to be specified; these can be exons, introns, or absolutely any task. The user can develop PCR sets based on an existing list of primers or probes from previously developed panels or for other purposes. Non-specific tails for primers can be added during the primer design stage.
By Ruslan Kalendar
email: [email protected]
Operating system(s): Platform independent
Programming language: Java 25 or higher
How do I set or change the Java path system variable
To install a specific version of OpenJDK using Conda, you need to specify the version number in your installation command and use the conda-forge channel. The latest version is available on the conda-forge channel.
- Add the conda-forge channel (if not already added). It is recommended to add the conda-forge channel to your configuration and set its priority to strict to ensure packages are preferentially installed from this channel:
conda config --add channels conda-forge
conda config --set channel_priority strict
- Create a new Conda environment and install the desired OpenJDK version. Creating a dedicated environment helps manage dependencies and avoid conflicts with other projects:
conda create -n java25 openjdk=25
- Activate the new environment:
conda activate java25
- Check if you have Java installed. The output should display information for the installed Java version:
java -version
To run the project from the command line. Command-line options, separated by spaces.
The executive file PCRpanel.jar is in the dist directory, which can be copied to any location.
Go to the target folder and type the following; an individual file or a file folder can be specified:
java -jar <PCRpanelPath>\dist\PCRpanel.jar <PCRpanelPath>\test\config.file
java -jar C:\PCRpanel\dist\PCRpanel.jar C:\PCRpanel\test\config.file
To enter parameters and specify the location of the target files and primer's file, you must specify this via a file on the command line. An example of such a file here (file name or extension does not matter):
config.file
target_path=C:\PCRpanel\test\NG_008690.txt
target_path=C:\PCRpanel\test\NG_011731.txt
target_path=C:\PCRpanel\test\NG_013019.txt
target_path=C:\PCRpanel\test\NG_008847.txt
target_path=C:\PCRpanel\test\NC_000002.txt
target_primers=C:\PCRpanel\test\primers.txt
minPCR=250
maxPCR=500
minLen=18
maxLen=24
minTm=60
maxTm=62
minLC=78
3end=w
5end=
forwardtail=ACACTCTTTCCCTACACGACGCTCTTCCGATCT
reversetail=GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
In the Genbank file ("FEATURES"), you must replace "mRNA" with "Panel" to indicate exon coordinates or other target fragments to the software.
Example: Homo sapiens HNF1 homeobox A: https://www.ncbi.nlm.nih.gov/nuccore/NG_011731.2?from=4823&to=28767&report=genbank
mRNA join(179..527,10266..10465,14953..15139,15597..15838,
17695..17846,17974..18175,18907..19098,20701..20822,
20916..21060,22498..23945)
replaced by:
Panel join(179..527,10266..10465,14953..15139,15597..15838,
17695..17846,17974..18175,18907..19098,20701..20822,
20916..21060,22498..23945)
Example: Severe acute respiratory syndrome coronavirus 2: https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2
For whole-genome tiling, it is necessary to specify the coordinates for developing a panel for the entire length of the virus genome.
Insert the following line ("Panel join(1..29842)") under the ("FEATURES") in this the Genbank file:
FEATURES Location/Qualifiers
Panel join(1..29842)
The target sequence is not limited by the presence of exons, as in the example with the HNF1 gene. Anyone can specify any coordinates and any number of them for any target sequence.