pfizer-opensource/nf-crispr-primer-design

Introduction

pfizer-opensource/nf-crispr-primer-design is a bioinformatics pipeline that designs primers for sequencing CRISPR-edited target sites. The pipeline takes CRISPR guide sequences as input, finds their location in a reference genome, and then designs primers to amplify the edited region. In addition to outputing target-specific primers, the pipeline can also generate primers with NGS adapter sequences added on. This pipeline is a companion to the pfizer-opensource/nf-gene-editing-ngs pipeline, and produces an amplicons.yaml file that is compatible with that gene editing NGS analysis pipeline.

Usage

Note

If you are new to Nextflow and nf-core, please refer to this page on how to set-up Nextflow.

The only required input file is a tab-delimited text file with guide identifiers and guide sequences. The input data should look like this:

guides.txt:

guide_id	guide_seq
HPRT-ctrl	AATTATGGGGATTACTAGGA

Each row represents a CRISPR guide, and a primer pair will be designed for that guide.

You will also need to tell the pipeline which reference genome to use for the primer design and a prefix string to use for naming the output files.

Now, you can run the pipeline using:

nextflow run pfizer-opensource/nf-crispr-primer-design \
   -profile <docker/singularity/.../institute> \
   --input guides.txt \
   --genome GRCh38 \
   --prefix my_guides \
   --outdir <OUTDIR>

Warning

Please provide pipeline parameters via the CLI or Nextflow -params-file option. Custom config files including those provided by the -c Nextflow option can be used to provide any configuration except for parameters; see docs.

Credits

pfizer-opensource/nf-crispr-primer-design was originally written by Jason Arroyo.

Contributions and Support

If you would like to contribute to this pipeline, please see the contributing guidelines.

Citations

An extensive list of references for the tools used by the pipeline can be found in the CITATIONS.md file.

This pipeline uses code and infrastructure developed and maintained by the nf-core community, reused here under the MIT license.

The nf-core framework for community-curated bioinformatics pipelines.

Philip Ewels, Alexander Peltzer, Sven Fillinger, Harshil Patel, Johannes Alneberg, Andreas Wilm, Maxime Ulysse Garcia, Paolo Di Tommaso & Sven Nahnsen.

Nat Biotechnol. 2020 Feb 13. doi: 10.1038/s41587-020-0439-x.