PyBioQuanta is a lightweight Python package offering 6 essential bioinformatics utilities.
It is designed for quick sequence operations, small analyses, and everyday bioinformatics tasks.
- FASTA Reader: Parse FASTA files into Python dictionaries.
- Reverse Complement: Get the reverse complement of DNA or RNA sequences.
- DNA Translator: Translate DNA sequences into protein.
- GC Content Calculator: Calculate GC percentage of a sequence.
- Motif Finder: Find positions of motifs (subsequences) inside sequences.
- Random DNA Generator: Create random DNA sequences of desired length.
You can install PyBioQuanta via pip:
pip install PyBioQuantafrom PyBioQuanta import read_fasta
sequences = read_fasta("example.fasta")
print(sequences)from PyBioQuanta import reverse_complement
seq = "ATCG"
rc = reverse_complement(seq)
print(rc)from PyBioQuanta import translate_dna
dna_seq = "ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG"
protein = translate_dna(dna_seq)
print(protein)from PyBioQuanta import gc_content
seq = "ATGCGC"
gc_percentage = gc_content(seq)
print(f"GC Content: {gc_percentage:.2f}%")
from PyBioQuanta import find_motif
seq = "ATGCGCGTAGCGC"
motif = "GCG"
positions = find_motif(seq, motif)
print(positions)from PyBioQuanta import generate_random_dna
random_seq = generate_random_dna(50)
print(random_seq)