uncaught exception of type std::out_of_range: basic_string

[karolina16]

Dear Developer Team,

many thanks for this useful tool. I am running flexiplex on Apple Silicon and the program runs but at a certain point it terminates.
This is my command and the message I get when it terminates.

paste o28140_1_1-AML2_S15_L002_R1_001.fastq o28140_1_1-AML2_S15_L002_R2_001.fastq |
sed "/^[@,+]/! s/\t/TTTTT/g" |
sed "/^[@,+]/! s/^/CTACACGACGCTCTTCCGATCT/g" |
./flexiplex-1.01/flexiplex -x "GCTATTCAAGATCTCTGTCTGGCAGTGGAGGAAGTCTCTCTTTAAGAAAATAG" -d grep |
./flexiplex-1.01/flexiplex -d 10x3v3

40.2 million reads processed..
libc++abi: terminating due to uncaught exception of type std::out_of_range: basic_string
Number of reads processed: 71
Number of reads where a barcode was found: 71
Number of reads where more than one barcode was found: 0
All done!
Reads Barcodes
3 1
2 7
1 54
[1] 44293 broken pipe paste |
44294 broken pipe sed "/^[@,+]/! s/\t/TTTTT/g" |
44295 broken pipe sed "/^[@,+]/! s/^/CTACACGACGCTCTTCCGATCT/g" |
44296 abort ./flexiplex-1.01/flexiplex -x -d grep |
44297 done ./flexiplex-1.01/flexiplex -d 10x3v3

I would greatly appreciate your support on that issue.

Thank you in advance and best wishes,
Karolina

[nadiadavidson]

Hi Karolina,

Thanks for reporting, this looks like a bug in flexiplex attempting to read outside of the string lengths, which we can investigate. Would you be happy to email us a small fastq that reproduces the error?

In the mean time, to check what's going wrong, can you run the "grep" and demultiplexing parts separately to see which is the issue? e.g.

paste o28140_1_1-AML2_S15_L002_R1_001.fastq o28140_1_1-AML2_S15_L002_R2_001.fastq |
./flexiplex-1.01/flexiplex -x "GCTATTCAAGATCTCTGTCTGGCAGTGGAGGAAGTCTCTCTTTAAGAAAATAG" -d grep

paste o28140_1_1-AML2_S15_L002_R1_001.fastq o28140_1_1-AML2_S15_L002_R2_001.fastq |
sed "/^[@,+]/! s/\t/TTTTT/g" |
sed "/^[@,+]/! s/^/CTACACGACGCTCTTCCGATCT/g" |
./flexiplex-1.01/flexiplex -d 10x3v3

I suspect it's the second command that's the problem. If that's the case, one thing worth trying is to add more buffer sequence around the barcodes. e.g.:
paste o28140_1_1-AML2_S15_L002_R1_001.fastq o28140_1_1-AML2_S15_L002_R2_001.fastq |
sed "/^[@,+]/! s/\t/TTTTTTTTTTTTTT/g" |
sed "/^[@,+]/! s/^/NNNNNNNNNNCTACACGACGCTCTTCCGATCT/g" |
./flexiplex-1.01/flexiplex -d 10x3v3

Please let us know if that helps at all.

Cheers,
Nadia.

[karolina16]

Hi Nadia,

thanks a lot for prompt reply. I managed to run the commands separately and they worked (even without more buffer around the barcodes). So it looks like the problem arises when I combine them. I will also share via email my input data.

Would be again greatful for your feedback.

Cheers,
Karolina

[nadiadavidson]

Just following up on this. I wonder if your issue if related to the one reported in #29. If so, it may have been fixed between the version you used (1.01) and the latest. Would you be happy to try the newest release and let us know if that works?

Cheers,
Nadia.