-
Notifications
You must be signed in to change notification settings - Fork 1
/
Copy pathexpected_output.json
127 lines (127 loc) · 131 KB
/
expected_output.json
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1450375701", "evidenceLevel": "3", "literature": ["30924126"], "genotype": "GG", "genotypeAnnotationText": "Patients with the GG genotype may have a decreased response to allopurinol as compared to patients with the AC, CC or CT genotypes. Other genetic and clinical factors may also affect a patient's response to allopurinol.", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "efficacy", "genotypeId": "21_45514912_G_G,G", "variantRsId": "rs4659982", "variantFunctionalConsequenceId": "SO_0002073", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1450375701", "evidenceLevel": "3", "literature": ["30924126"], "genotype": "GC", "genotypeAnnotationText": "Patients with the GC genotype may have an increased response to allopurinol as compared to patients with the AA, AT or TT genotypes. Other genetic and clinical factors may also affect a patient's response to allopurinol.", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "efficacy", "genotypeId": "21_45514912_G_C,G", "variantRsId": "rs4659982", "variantFunctionalConsequenceId": "SO_0001624", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1450375701", "evidenceLevel": "3", "literature": ["30924126"], "genotype": "GT", "genotypeAnnotationText": "Patients with the GT genotype may have a decreased response to allopurinol as compared to patients with the AC, CC or CT genotypes. Other genetic and clinical factors may also affect a patient's response to allopurinol.", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "efficacy", "genotypeId": "21_45514912_G_G,T", "variantRsId": "rs4659982", "variantFunctionalConsequenceId": "SO_0001624", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1450375701", "evidenceLevel": "3", "literature": ["30924126"], "genotype": "CC", "genotypeAnnotationText": "Patients with the CC genotype may have an increased response to allopurinol as compared to patients with the AA, AT or TT genotypes. Other genetic and clinical factors may also affect a patient's response to allopurinol.", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "efficacy", "genotypeId": "21_45514912_G_C,C", "variantRsId": "rs4659982", "variantFunctionalConsequenceId": "SO_0001624", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1450375701", "evidenceLevel": "3", "literature": ["30924126"], "genotype": "CT", "genotypeAnnotationText": "Patients with the CT genotype may have an increased response to allopurinol as compared to patients with the AA, AT or TT genotypes. Other genetic and clinical factors may also affect a patient's response to allopurinol.", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "efficacy", "genotypeId": "21_45514912_G_C,T", "variantRsId": "rs4659982", "variantFunctionalConsequenceId": "SO_0001624", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1450375701", "evidenceLevel": "3", "literature": ["30924126"], "genotype": "TT", "genotypeAnnotationText": "Patients with the TT genotype may have a decreased response to allopurinol as compared to patients with the AC, CC or CT genotypes. Other genetic and clinical factors may also affect a patient's response to allopurinol.", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "efficacy", "genotypeId": "21_45514912_G_T,T", "variantRsId": "rs4659982", "variantFunctionalConsequenceId": "SO_0001624", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1448603303", "evidenceLevel": "3", "literature": ["25558980"], "genotype": "AA", "genotypeAnnotationText": "Children with the AA genotype who are undergoing a tonsillectomy may have an increased risk for post-operative nausea and vomiting (PONV) when treated with morphine as compared to patients with the GG genotype. Other genetic and clinical factors may also influence risk of PONV.", "drugs": [{"drugFromSource": "morphine"}], "pgxCategory": "toxicity", "genotypeId": "21_36070377_G_A,A", "variantRsId": "rs3766246", "variantFunctionalConsequenceId": "SO_0001583", "targetFromSourceId": "ENSG00000159228"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1448603303", "evidenceLevel": "3", "literature": ["25558980"], "genotype": "AA", "genotypeAnnotationText": "Children with the AA genotype who are undergoing a tonsillectomy may have an increased risk for post-operative nausea and vomiting (PONV) when treated with morphine as compared to patients with the GG genotype. Other genetic and clinical factors may also influence risk of PONV.", "drugs": [{"drugFromSource": "morphine"}], "pgxCategory": "toxicity", "genotypeId": "21_36070377_G_A,A", "variantRsId": "rs3766246", "variantFunctionalConsequenceId": "SO_0001627", "targetFromSourceId": "ENSG00000185917"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1448603303", "evidenceLevel": "3", "literature": ["25558980"], "genotype": "AG", "genotypeAnnotationText": "Children with the AG genotype who are undergoing a tonsillectomy may have an increased risk for post-operative nausea and vomiting (PONV) when treated with morphine as compared to patients with the GG genotype. Other genetic and clinical factors may also influence risk of PONV.", "drugs": [{"drugFromSource": "morphine"}], "pgxCategory": "toxicity", "genotypeId": "21_36070377_G_A,G", "variantRsId": "rs3766246", "variantFunctionalConsequenceId": "SO_0001583", "targetFromSourceId": "ENSG00000159228"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1448603303", "evidenceLevel": "3", "literature": ["25558980"], "genotype": "AG", "genotypeAnnotationText": "Children with the AG genotype who are undergoing a tonsillectomy may have an increased risk for post-operative nausea and vomiting (PONV) when treated with morphine as compared to patients with the GG genotype. Other genetic and clinical factors may also influence risk of PONV.", "drugs": [{"drugFromSource": "morphine"}], "pgxCategory": "toxicity", "genotypeId": "21_36070377_G_A,G", "variantRsId": "rs3766246", "variantFunctionalConsequenceId": "SO_0001627", "targetFromSourceId": "ENSG00000185917"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1448603303", "evidenceLevel": "3", "literature": ["25558980"], "genotype": "GG", "genotypeAnnotationText": "Children with the GG genotype who are undergoing a tonsillectomy may have a decreased risk for post-operative nausea and vomiting (PONV) when treated with morphine as compared to patients with the AA or AG genotype. Other genetic and clinical factors may also influence risk of PONV.", "drugs": [{"drugFromSource": "morphine"}], "pgxCategory": "toxicity", "genotypeId": "21_36070377_G_G,G", "variantRsId": "rs3766246", "variantFunctionalConsequenceId": "SO_0002073", "targetFromSourceId": "ENSG00000159228"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1448603303", "evidenceLevel": "3", "literature": ["25558980"], "genotype": "GG", "genotypeAnnotationText": "Children with the GG genotype who are undergoing a tonsillectomy may have a decreased risk for post-operative nausea and vomiting (PONV) when treated with morphine as compared to patients with the AA or AG genotype. Other genetic and clinical factors may also influence risk of PONV.", "drugs": [{"drugFromSource": "morphine"}], "pgxCategory": "toxicity", "genotypeId": "21_36070377_G_G,G", "variantRsId": "rs3766246", "variantFunctionalConsequenceId": "SO_0002073", "targetFromSourceId": "ENSG00000185917"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1043880328", "evidenceLevel": "3", "literature": ["21435719"], "genotype": "AA", "genotypeAnnotationText": "Patients with the AA genotype may have increased likelihood of Neurotoxicity when treated with thalidomide in people with Multiple Myeloma as compared to patients with the AG genotype. Other clinical or genetic factors may also influence a patient's response to thalidomide.", "drugs": [{"drugFromSource": "thalidomide"}], "pgxCategory": "toxicity", "phenotypeText": "Multiple Myeloma", "phenotypeFromSourceId": "EFO_0001378", "variantRsId": "rs4630"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1043880328", "evidenceLevel": "3", "literature": ["21435719"], "genotype": "AG", "genotypeAnnotationText": "Patients with the AG genotype may have decreased likelihood of Neurotoxicity when treated with thalidomide in people with Multiple Myeloma as compared to patients with the AA genotype. Other clinical or genetic factors may also influence a patient's response to thalidomide.", "drugs": [{"drugFromSource": "thalidomide"}], "pgxCategory": "toxicity", "phenotypeText": "Multiple Myeloma", "phenotypeFromSourceId": "EFO_0001378", "variantRsId": "rs4630"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1043880328", "evidenceLevel": "3", "literature": ["21435719"], "genotype": "GG", "genotypeAnnotationText": "Patients with the GG genotype may have decreased likelihood of Neurotoxicity when treated with thalidomide in people with Multiple Myeloma as compared to patients with the AA genotype. Other clinical or genetic factors may also influence a patient's response to thalidomide.", "drugs": [{"drugFromSource": "thalidomide"}], "pgxCategory": "toxicity", "phenotypeText": "Multiple Myeloma", "phenotypeFromSourceId": "EFO_0001378", "variantRsId": "rs4630"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1183680546", "evidenceLevel": "1A", "literature": ["27711230", "22626609", "26191484", "26670100", "28469811"], "genotype": "CC", "genotypeAnnotationText": "Patients with the rs12979860 CC genotype and hepatitis C infection may have increased response to triple therapy (boceprevir, peginterferon alfa-2a/2b and ribavirin) as compared to patients with the CT or TT genotype. Other genetic and clinical factors may also influence response to boceprevir-peginterferon based therapy.", "drugs": [{"drugFromSource": "boceprevir"}], "pgxCategory": "efficacy", "phenotypeText": "Hepatitis C, Chronic", "genotypeId": "21_45537880_T_C,C", "variantRsId": "rs12979860", "variantFunctionalConsequenceId": "SO_0001583", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1183680546", "evidenceLevel": "1A", "literature": ["27711230", "22626609", "26191484", "26670100", "28469811"], "genotype": "CC", "genotypeAnnotationText": "Patients with the rs12979860 CC genotype and hepatitis C infection may have increased response to triple therapy (boceprevir, peginterferon alfa-2a/2b and ribavirin) as compared to patients with the CT or TT genotype. Other genetic and clinical factors may also influence response to boceprevir-peginterferon based therapy.", "drugs": [{"drugFromSource": "peginterferon alfa-2a"}], "pgxCategory": "efficacy", "phenotypeText": "Hepatitis C, Chronic", "genotypeId": "21_45537880_T_C,C", "variantRsId": "rs12979860", "variantFunctionalConsequenceId": "SO_0001583", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1183680546", "evidenceLevel": "1A", "literature": ["27711230", "22626609", "26191484", "26670100", "28469811"], "genotype": "CC", "genotypeAnnotationText": "Patients with the rs12979860 CC genotype and hepatitis C infection may have increased response to triple therapy (boceprevir, peginterferon alfa-2a/2b and ribavirin) as compared to patients with the CT or TT genotype. Other genetic and clinical factors may also influence response to boceprevir-peginterferon based therapy.", "drugs": [{"drugFromSource": "peginterferon alfa-2b"}], "pgxCategory": "efficacy", "phenotypeText": "Hepatitis C, Chronic", "genotypeId": "21_45537880_T_C,C", "variantRsId": "rs12979860", "variantFunctionalConsequenceId": "SO_0001583", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1183680546", "evidenceLevel": "1A", "literature": ["27711230", "22626609", "26191484", "26670100", "28469811"], "genotype": "CC", "genotypeAnnotationText": "Patients with the rs12979860 CC genotype and hepatitis C infection may have increased response to triple therapy (boceprevir, peginterferon alfa-2a/2b and ribavirin) as compared to patients with the CT or TT genotype. Other genetic and clinical factors may also influence response to boceprevir-peginterferon based therapy.", "drugs": [{"drugFromSource": "ribavirin"}], "pgxCategory": "efficacy", "phenotypeText": "Hepatitis C, Chronic", "genotypeId": "21_45537880_T_C,C", "variantRsId": "rs12979860", "variantFunctionalConsequenceId": "SO_0001583", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1183680546", "evidenceLevel": "1A", "literature": ["27711230", "22626609", "26191484", "26670100", "28469811"], "genotype": "CT", "genotypeAnnotationText": "Patients with the rs12979860 CT genotype and hepatitis C infection may have decreased response to triple therapy (boceprevir, peginterferon alfa-2a/2b and ribavirin) as compared to patients with the CC genotype. Other genetic and clinical factors may also influence response to boceprevir-peginterferon based therapy.", "drugs": [{"drugFromSource": "boceprevir"}], "pgxCategory": "efficacy", "phenotypeText": "Hepatitis C, Chronic", "genotypeId": "21_45537880_T_C,T", "variantRsId": "rs12979860", "variantFunctionalConsequenceId": "SO_0001583", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1183680546", "evidenceLevel": "1A", "literature": ["27711230", "22626609", "26191484", "26670100", "28469811"], "genotype": "CT", "genotypeAnnotationText": "Patients with the rs12979860 CT genotype and hepatitis C infection may have decreased response to triple therapy (boceprevir, peginterferon alfa-2a/2b and ribavirin) as compared to patients with the CC genotype. Other genetic and clinical factors may also influence response to boceprevir-peginterferon based therapy.", "drugs": [{"drugFromSource": "peginterferon alfa-2a"}], "pgxCategory": "efficacy", "phenotypeText": "Hepatitis C, Chronic", "genotypeId": "21_45537880_T_C,T", "variantRsId": "rs12979860", "variantFunctionalConsequenceId": "SO_0001583", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1183680546", "evidenceLevel": "1A", "literature": ["27711230", "22626609", "26191484", "26670100", "28469811"], "genotype": "CT", "genotypeAnnotationText": "Patients with the rs12979860 CT genotype and hepatitis C infection may have decreased response to triple therapy (boceprevir, peginterferon alfa-2a/2b and ribavirin) as compared to patients with the CC genotype. Other genetic and clinical factors may also influence response to boceprevir-peginterferon based therapy.", "drugs": [{"drugFromSource": "peginterferon alfa-2b"}], "pgxCategory": "efficacy", "phenotypeText": "Hepatitis C, Chronic", "genotypeId": "21_45537880_T_C,T", "variantRsId": "rs12979860", "variantFunctionalConsequenceId": "SO_0001583", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1183680546", "evidenceLevel": "1A", "literature": ["27711230", "22626609", "26191484", "26670100", "28469811"], "genotype": "CT", "genotypeAnnotationText": "Patients with the rs12979860 CT genotype and hepatitis C infection may have decreased response to triple therapy (boceprevir, peginterferon alfa-2a/2b and ribavirin) as compared to patients with the CC genotype. Other genetic and clinical factors may also influence response to boceprevir-peginterferon based therapy.", "drugs": [{"drugFromSource": "ribavirin"}], "pgxCategory": "efficacy", "phenotypeText": "Hepatitis C, Chronic", "genotypeId": "21_45537880_T_C,T", "variantRsId": "rs12979860", "variantFunctionalConsequenceId": "SO_0001583", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1183680546", "evidenceLevel": "1A", "literature": ["27711230", "22626609", "26191484", "26670100", "28469811"], "genotype": "TT", "genotypeAnnotationText": "Patients with the rs12979860 TT genotype and hepatitis C infection may have decreased response to triple therapy (boceprevir, peginterferon alfa-2a/2b and ribavirin) as compared to patients with the CC genotype. Other genetic and clinical factors may also influence response to boceprevir-peginterferon based therapy.", "drugs": [{"drugFromSource": "boceprevir"}], "pgxCategory": "efficacy", "phenotypeText": "Hepatitis C, Chronic", "genotypeId": "21_45537880_T_T,T", "variantRsId": "rs12979860", "variantFunctionalConsequenceId": "SO_0002073", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1183680546", "evidenceLevel": "1A", "literature": ["27711230", "22626609", "26191484", "26670100", "28469811"], "genotype": "TT", "genotypeAnnotationText": "Patients with the rs12979860 TT genotype and hepatitis C infection may have decreased response to triple therapy (boceprevir, peginterferon alfa-2a/2b and ribavirin) as compared to patients with the CC genotype. Other genetic and clinical factors may also influence response to boceprevir-peginterferon based therapy.", "drugs": [{"drugFromSource": "peginterferon alfa-2a"}], "pgxCategory": "efficacy", "phenotypeText": "Hepatitis C, Chronic", "genotypeId": "21_45537880_T_T,T", "variantRsId": "rs12979860", "variantFunctionalConsequenceId": "SO_0002073", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1183680546", "evidenceLevel": "1A", "literature": ["27711230", "22626609", "26191484", "26670100", "28469811"], "genotype": "TT", "genotypeAnnotationText": "Patients with the rs12979860 TT genotype and hepatitis C infection may have decreased response to triple therapy (boceprevir, peginterferon alfa-2a/2b and ribavirin) as compared to patients with the CC genotype. Other genetic and clinical factors may also influence response to boceprevir-peginterferon based therapy.", "drugs": [{"drugFromSource": "peginterferon alfa-2b"}], "pgxCategory": "efficacy", "phenotypeText": "Hepatitis C, Chronic", "genotypeId": "21_45537880_T_T,T", "variantRsId": "rs12979860", "variantFunctionalConsequenceId": "SO_0002073", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1183680546", "evidenceLevel": "1A", "literature": ["27711230", "22626609", "26191484", "26670100", "28469811"], "genotype": "TT", "genotypeAnnotationText": "Patients with the rs12979860 TT genotype and hepatitis C infection may have decreased response to triple therapy (boceprevir, peginterferon alfa-2a/2b and ribavirin) as compared to patients with the CC genotype. Other genetic and clinical factors may also influence response to boceprevir-peginterferon based therapy.", "drugs": [{"drugFromSource": "ribavirin"}], "pgxCategory": "efficacy", "phenotypeText": "Hepatitis C, Chronic", "genotypeId": "21_45537880_T_T,T", "variantRsId": "rs12979860", "variantFunctionalConsequenceId": "SO_0002073", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449309937", "evidenceLevel": "1A", "literature": ["27857962", "11389482"], "genotype": "AAG/AAG", "genotypeAnnotationText": "Patients with the rs121918596 AAG/AAG genotype may have a decreased, but not absent, risk for malignant hyperthermia based on this variant when treated with volatile anesthetics (desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane) and/or succinylcholine as compared to patients with the del/del or del/GAG genotypes. Other genetic or clinical factors may also influence the risk for malignant hyperthermia.", "drugs": [{"drugFromSource": "desflurane"}], "pgxCategory": "toxicity", "phenotypeText": "Malignant Hyperthermia", "phenotypeFromSourceId": "HP_0002047", "genotypeId": "21_45514946_CAAG_CAAG,CAAG", "variantRsId": "rs121918596", "variantFunctionalConsequenceId": "SO_0002073", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449309937", "evidenceLevel": "1A", "literature": ["27857962", "11389482"], "genotype": "AAG/AAG", "genotypeAnnotationText": "Patients with the rs121918596 AAG/AAG genotype may have a decreased, but not absent, risk for malignant hyperthermia based on this variant when treated with volatile anesthetics (desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane) and/or succinylcholine as compared to patients with the del/del or del/GAG genotypes. Other genetic or clinical factors may also influence the risk for malignant hyperthermia.", "drugs": [{"drugFromSource": "enflurane"}], "pgxCategory": "toxicity", "phenotypeText": "Malignant Hyperthermia", "phenotypeFromSourceId": "HP_0002047", "genotypeId": "21_45514946_CAAG_CAAG,CAAG", "variantRsId": "rs121918596", "variantFunctionalConsequenceId": "SO_0002073", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449309937", "evidenceLevel": "1A", "literature": ["27857962", "11389482"], "genotype": "AAG/AAG", "genotypeAnnotationText": "Patients with the rs121918596 AAG/AAG genotype may have a decreased, but not absent, risk for malignant hyperthermia based on this variant when treated with volatile anesthetics (desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane) and/or succinylcholine as compared to patients with the del/del or del/GAG genotypes. Other genetic or clinical factors may also influence the risk for malignant hyperthermia.", "drugs": [{"drugFromSource": "halothane"}], "pgxCategory": "toxicity", "phenotypeText": "Malignant Hyperthermia", "phenotypeFromSourceId": "HP_0002047", "genotypeId": "21_45514946_CAAG_CAAG,CAAG", "variantRsId": "rs121918596", "variantFunctionalConsequenceId": "SO_0002073", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449309937", "evidenceLevel": "1A", "literature": ["27857962", "11389482"], "genotype": "AAG/AAG", "genotypeAnnotationText": "Patients with the rs121918596 AAG/AAG genotype may have a decreased, but not absent, risk for malignant hyperthermia based on this variant when treated with volatile anesthetics (desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane) and/or succinylcholine as compared to patients with the del/del or del/GAG genotypes. Other genetic or clinical factors may also influence the risk for malignant hyperthermia.", "drugs": [{"drugFromSource": "isoflurane"}], "pgxCategory": "toxicity", "phenotypeText": "Malignant Hyperthermia", "phenotypeFromSourceId": "HP_0002047", "genotypeId": "21_45514946_CAAG_CAAG,CAAG", "variantRsId": "rs121918596", "variantFunctionalConsequenceId": "SO_0002073", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449309937", "evidenceLevel": "1A", "literature": ["27857962", "11389482"], "genotype": "AAG/AAG", "genotypeAnnotationText": "Patients with the rs121918596 AAG/AAG genotype may have a decreased, but not absent, risk for malignant hyperthermia based on this variant when treated with volatile anesthetics (desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane) and/or succinylcholine as compared to patients with the del/del or del/GAG genotypes. Other genetic or clinical factors may also influence the risk for malignant hyperthermia.", "drugs": [{"drugFromSource": "methoxyflurane"}], "pgxCategory": "toxicity", "phenotypeText": "Malignant Hyperthermia", "phenotypeFromSourceId": "HP_0002047", "genotypeId": "21_45514946_CAAG_CAAG,CAAG", "variantRsId": "rs121918596", "variantFunctionalConsequenceId": "SO_0002073", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449309937", "evidenceLevel": "1A", "literature": ["27857962", "11389482"], "genotype": "AAG/AAG", "genotypeAnnotationText": "Patients with the rs121918596 AAG/AAG genotype may have a decreased, but not absent, risk for malignant hyperthermia based on this variant when treated with volatile anesthetics (desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane) and/or succinylcholine as compared to patients with the del/del or del/GAG genotypes. Other genetic or clinical factors may also influence the risk for malignant hyperthermia.", "drugs": [{"drugFromSource": "sevoflurane"}], "pgxCategory": "toxicity", "phenotypeText": "Malignant Hyperthermia", "phenotypeFromSourceId": "HP_0002047", "genotypeId": "21_45514946_CAAG_CAAG,CAAG", "variantRsId": "rs121918596", "variantFunctionalConsequenceId": "SO_0002073", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449309937", "evidenceLevel": "1A", "literature": ["27857962", "11389482"], "genotype": "AAG/AAG", "genotypeAnnotationText": "Patients with the rs121918596 AAG/AAG genotype may have a decreased, but not absent, risk for malignant hyperthermia based on this variant when treated with volatile anesthetics (desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane) and/or succinylcholine as compared to patients with the del/del or del/GAG genotypes. Other genetic or clinical factors may also influence the risk for malignant hyperthermia.", "drugs": [{"drugFromSource": "succinylcholine"}], "pgxCategory": "toxicity", "phenotypeText": "Malignant Hyperthermia", "phenotypeFromSourceId": "HP_0002047", "genotypeId": "21_45514946_CAAG_CAAG,CAAG", "variantRsId": "rs121918596", "variantFunctionalConsequenceId": "SO_0002073", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449309937", "evidenceLevel": "1A", "literature": ["27857962", "11389482"], "genotype": "del/AAG", "genotypeAnnotationText": "Patients with the rs121918596 del/AAG genotype may develop malignant hyperthermia when treated with volatile anesthetics (desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane) and/or succinylcholine as compared to patients with the GAG/GAG genotype. Other genetic or clinical factors may also influence the risk for malignant hyperthermia.", "drugs": [{"drugFromSource": "desflurane"}], "pgxCategory": "toxicity", "phenotypeText": "Malignant Hyperthermia", "phenotypeFromSourceId": "HP_0002047", "genotypeId": "21_45514946_CAAG_C,CAAG", "variantRsId": "rs121918596", "variantFunctionalConsequenceId": "SO_0001624", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449309937", "evidenceLevel": "1A", "literature": ["27857962", "11389482"], "genotype": "del/AAG", "genotypeAnnotationText": "Patients with the rs121918596 del/AAG genotype may develop malignant hyperthermia when treated with volatile anesthetics (desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane) and/or succinylcholine as compared to patients with the GAG/GAG genotype. Other genetic or clinical factors may also influence the risk for malignant hyperthermia.", "drugs": [{"drugFromSource": "enflurane"}], "pgxCategory": "toxicity", "phenotypeText": "Malignant Hyperthermia", "phenotypeFromSourceId": "HP_0002047", "genotypeId": "21_45514946_CAAG_C,CAAG", "variantRsId": "rs121918596", "variantFunctionalConsequenceId": "SO_0001624", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449309937", "evidenceLevel": "1A", "literature": ["27857962", "11389482"], "genotype": "del/AAG", "genotypeAnnotationText": "Patients with the rs121918596 del/AAG genotype may develop malignant hyperthermia when treated with volatile anesthetics (desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane) and/or succinylcholine as compared to patients with the GAG/GAG genotype. Other genetic or clinical factors may also influence the risk for malignant hyperthermia.", "drugs": [{"drugFromSource": "halothane"}], "pgxCategory": "toxicity", "phenotypeText": "Malignant Hyperthermia", "phenotypeFromSourceId": "HP_0002047", "genotypeId": "21_45514946_CAAG_C,CAAG", "variantRsId": "rs121918596", "variantFunctionalConsequenceId": "SO_0001624", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449309937", "evidenceLevel": "1A", "literature": ["27857962", "11389482"], "genotype": "del/AAG", "genotypeAnnotationText": "Patients with the rs121918596 del/AAG genotype may develop malignant hyperthermia when treated with volatile anesthetics (desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane) and/or succinylcholine as compared to patients with the GAG/GAG genotype. Other genetic or clinical factors may also influence the risk for malignant hyperthermia.", "drugs": [{"drugFromSource": "isoflurane"}], "pgxCategory": "toxicity", "phenotypeText": "Malignant Hyperthermia", "phenotypeFromSourceId": "HP_0002047", "genotypeId": "21_45514946_CAAG_C,CAAG", "variantRsId": "rs121918596", "variantFunctionalConsequenceId": "SO_0001624", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449309937", "evidenceLevel": "1A", "literature": ["27857962", "11389482"], "genotype": "del/AAG", "genotypeAnnotationText": "Patients with the rs121918596 del/AAG genotype may develop malignant hyperthermia when treated with volatile anesthetics (desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane) and/or succinylcholine as compared to patients with the GAG/GAG genotype. Other genetic or clinical factors may also influence the risk for malignant hyperthermia.", "drugs": [{"drugFromSource": "methoxyflurane"}], "pgxCategory": "toxicity", "phenotypeText": "Malignant Hyperthermia", "phenotypeFromSourceId": "HP_0002047", "genotypeId": "21_45514946_CAAG_C,CAAG", "variantRsId": "rs121918596", "variantFunctionalConsequenceId": "SO_0001624", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449309937", "evidenceLevel": "1A", "literature": ["27857962", "11389482"], "genotype": "del/AAG", "genotypeAnnotationText": "Patients with the rs121918596 del/AAG genotype may develop malignant hyperthermia when treated with volatile anesthetics (desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane) and/or succinylcholine as compared to patients with the GAG/GAG genotype. Other genetic or clinical factors may also influence the risk for malignant hyperthermia.", "drugs": [{"drugFromSource": "sevoflurane"}], "pgxCategory": "toxicity", "phenotypeText": "Malignant Hyperthermia", "phenotypeFromSourceId": "HP_0002047", "genotypeId": "21_45514946_CAAG_C,CAAG", "variantRsId": "rs121918596", "variantFunctionalConsequenceId": "SO_0001624", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449309937", "evidenceLevel": "1A", "literature": ["27857962", "11389482"], "genotype": "del/AAG", "genotypeAnnotationText": "Patients with the rs121918596 del/AAG genotype may develop malignant hyperthermia when treated with volatile anesthetics (desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane) and/or succinylcholine as compared to patients with the GAG/GAG genotype. Other genetic or clinical factors may also influence the risk for malignant hyperthermia.", "drugs": [{"drugFromSource": "succinylcholine"}], "pgxCategory": "toxicity", "phenotypeText": "Malignant Hyperthermia", "phenotypeFromSourceId": "HP_0002047", "genotypeId": "21_45514946_CAAG_C,CAAG", "variantRsId": "rs121918596", "variantFunctionalConsequenceId": "SO_0001624", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449309937", "evidenceLevel": "1A", "literature": ["27857962", "11389482"], "genotype": "del/del", "genotypeAnnotationText": "Patients with the rs121918596 del/del genotype may develop malignant hyperthermia when treated with volatile anesthetics (desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane) and/or succinylcholine as compared to patients with the GAG/GAG genotype. Other genetic or clinical factors may also influence the risk for malignant hyperthermia.", "drugs": [{"drugFromSource": "desflurane"}], "pgxCategory": "toxicity", "phenotypeText": "Malignant Hyperthermia", "phenotypeFromSourceId": "HP_0002047", "genotypeId": "21_45514946_CAAG_C,C", "variantRsId": "rs121918596", "variantFunctionalConsequenceId": "SO_0001624", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449309937", "evidenceLevel": "1A", "literature": ["27857962", "11389482"], "genotype": "del/del", "genotypeAnnotationText": "Patients with the rs121918596 del/del genotype may develop malignant hyperthermia when treated with volatile anesthetics (desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane) and/or succinylcholine as compared to patients with the GAG/GAG genotype. Other genetic or clinical factors may also influence the risk for malignant hyperthermia.", "drugs": [{"drugFromSource": "enflurane"}], "pgxCategory": "toxicity", "phenotypeText": "Malignant Hyperthermia", "phenotypeFromSourceId": "HP_0002047", "genotypeId": "21_45514946_CAAG_C,C", "variantRsId": "rs121918596", "variantFunctionalConsequenceId": "SO_0001624", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449309937", "evidenceLevel": "1A", "literature": ["27857962", "11389482"], "genotype": "del/del", "genotypeAnnotationText": "Patients with the rs121918596 del/del genotype may develop malignant hyperthermia when treated with volatile anesthetics (desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane) and/or succinylcholine as compared to patients with the GAG/GAG genotype. Other genetic or clinical factors may also influence the risk for malignant hyperthermia.", "drugs": [{"drugFromSource": "halothane"}], "pgxCategory": "toxicity", "phenotypeText": "Malignant Hyperthermia", "phenotypeFromSourceId": "HP_0002047", "genotypeId": "21_45514946_CAAG_C,C", "variantRsId": "rs121918596", "variantFunctionalConsequenceId": "SO_0001624", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449309937", "evidenceLevel": "1A", "literature": ["27857962", "11389482"], "genotype": "del/del", "genotypeAnnotationText": "Patients with the rs121918596 del/del genotype may develop malignant hyperthermia when treated with volatile anesthetics (desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane) and/or succinylcholine as compared to patients with the GAG/GAG genotype. Other genetic or clinical factors may also influence the risk for malignant hyperthermia.", "drugs": [{"drugFromSource": "isoflurane"}], "pgxCategory": "toxicity", "phenotypeText": "Malignant Hyperthermia", "phenotypeFromSourceId": "HP_0002047", "genotypeId": "21_45514946_CAAG_C,C", "variantRsId": "rs121918596", "variantFunctionalConsequenceId": "SO_0001624", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449309937", "evidenceLevel": "1A", "literature": ["27857962", "11389482"], "genotype": "del/del", "genotypeAnnotationText": "Patients with the rs121918596 del/del genotype may develop malignant hyperthermia when treated with volatile anesthetics (desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane) and/or succinylcholine as compared to patients with the GAG/GAG genotype. Other genetic or clinical factors may also influence the risk for malignant hyperthermia.", "drugs": [{"drugFromSource": "methoxyflurane"}], "pgxCategory": "toxicity", "phenotypeText": "Malignant Hyperthermia", "phenotypeFromSourceId": "HP_0002047", "genotypeId": "21_45514946_CAAG_C,C", "variantRsId": "rs121918596", "variantFunctionalConsequenceId": "SO_0001624", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449309937", "evidenceLevel": "1A", "literature": ["27857962", "11389482"], "genotype": "del/del", "genotypeAnnotationText": "Patients with the rs121918596 del/del genotype may develop malignant hyperthermia when treated with volatile anesthetics (desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane) and/or succinylcholine as compared to patients with the GAG/GAG genotype. Other genetic or clinical factors may also influence the risk for malignant hyperthermia.", "drugs": [{"drugFromSource": "sevoflurane"}], "pgxCategory": "toxicity", "phenotypeText": "Malignant Hyperthermia", "phenotypeFromSourceId": "HP_0002047", "genotypeId": "21_45514946_CAAG_C,C", "variantRsId": "rs121918596", "variantFunctionalConsequenceId": "SO_0001624", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449309937", "evidenceLevel": "1A", "literature": ["27857962", "11389482"], "genotype": "del/del", "genotypeAnnotationText": "Patients with the rs121918596 del/del genotype may develop malignant hyperthermia when treated with volatile anesthetics (desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane) and/or succinylcholine as compared to patients with the GAG/GAG genotype. Other genetic or clinical factors may also influence the risk for malignant hyperthermia.", "drugs": [{"drugFromSource": "succinylcholine"}], "pgxCategory": "toxicity", "phenotypeText": "Malignant Hyperthermia", "phenotypeFromSourceId": "HP_0002047", "genotypeId": "21_45514946_CAAG_C,C", "variantRsId": "rs121918596", "variantFunctionalConsequenceId": "SO_0001624", "targetFromSourceId": "ENSG00000173638"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1447680028", "evidenceLevel": "3", "literature": ["26633805"], "genotype": "ATTTGTTCATGCCT/ATTTGTTCATGCCT", "genotypeAnnotationText": "Patients with colorectal cancer and the HLA-G ATTTGTTCATGCCT/ATTTGTTCATGCCT genotype may have better response to capecitabine or fluorouracil as compared to patients with the HLA-G del/del genotypes. Other clinical and genetic factors may also influence response to capecitabine or fluorouracil in patients with colorectal cancer.", "drugs": [{"drugFromSource": "capecitabine"}], "pgxCategory": "efficacy", "phenotypeText": "Colorectal Neoplasms", "genotypeId": "21_29830804_T_TATTTGTTCATGCCT,TATTTGTTCATGCCT", "variantRsId": "rs371194629", "variantFunctionalConsequenceId": "SO_0001627", "targetFromSourceId": "ENSG00000171189"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1447680028", "evidenceLevel": "3", "literature": ["26633805"], "genotype": "ATTTGTTCATGCCT/ATTTGTTCATGCCT", "genotypeAnnotationText": "Patients with colorectal cancer and the HLA-G ATTTGTTCATGCCT/ATTTGTTCATGCCT genotype may have better response to capecitabine or fluorouracil as compared to patients with the HLA-G del/del genotypes. Other clinical and genetic factors may also influence response to capecitabine or fluorouracil in patients with colorectal cancer.", "drugs": [{"drugFromSource": "fluorouracil"}], "pgxCategory": "efficacy", "phenotypeText": "Colorectal Neoplasms", "genotypeId": "21_29830804_T_TATTTGTTCATGCCT,TATTTGTTCATGCCT", "variantRsId": "rs371194629", "variantFunctionalConsequenceId": "SO_0001627", "targetFromSourceId": "ENSG00000171189"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1447680028", "evidenceLevel": "3", "literature": ["26633805"], "genotype": "del/ATTTGTTCATGCCT", "genotypeAnnotationText": "Patients with colorectal cancer and the HLA-G del/ATTTGTTCATGCCT genotype may have better response to capecitabine or fluorouracil as compared to patients with the HLA-G del/del genotypes. Other clinical and genetic factors may also influence response to capecitabine or fluorouracil in patients with colorectal cancer.", "drugs": [{"drugFromSource": "capecitabine"}], "pgxCategory": "efficacy", "phenotypeText": "Colorectal Neoplasms", "genotypeId": "21_29830804_T_T,TATTTGTTCATGCCT", "variantRsId": "rs371194629", "variantFunctionalConsequenceId": "SO_0001627", "targetFromSourceId": "ENSG00000171189"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1447680028", "evidenceLevel": "3", "literature": ["26633805"], "genotype": "del/ATTTGTTCATGCCT", "genotypeAnnotationText": "Patients with colorectal cancer and the HLA-G del/ATTTGTTCATGCCT genotype may have better response to capecitabine or fluorouracil as compared to patients with the HLA-G del/del genotypes. Other clinical and genetic factors may also influence response to capecitabine or fluorouracil in patients with colorectal cancer.", "drugs": [{"drugFromSource": "fluorouracil"}], "pgxCategory": "efficacy", "phenotypeText": "Colorectal Neoplasms", "genotypeId": "21_29830804_T_T,TATTTGTTCATGCCT", "variantRsId": "rs371194629", "variantFunctionalConsequenceId": "SO_0001627", "targetFromSourceId": "ENSG00000171189"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1447680028", "evidenceLevel": "3", "literature": ["26633805"], "genotype": "del/del", "genotypeAnnotationText": "Patients with colorectal cancer and the HLA-G del/del genotype may have a worse response to capecitabine or fluorouracil as compared to patients with the HLA-G del/ATTTGTTCATGCCT or ATTTGTTCATGCCT/ATTTGTTCATGCCT genotypes. Other clinical and genetic factors may also influence response to capecitabine or fluorouracil in patients with colorectal cancer.", "drugs": [{"drugFromSource": "capecitabine"}], "pgxCategory": "efficacy", "phenotypeText": "Colorectal Neoplasms", "genotypeId": "21_29830804_T_T,T", "variantRsId": "rs371194629", "variantFunctionalConsequenceId": "SO_0002073", "targetFromSourceId": "ENSG00000171189"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1447680028", "evidenceLevel": "3", "literature": ["26633805"], "genotype": "del/del", "genotypeAnnotationText": "Patients with colorectal cancer and the HLA-G del/del genotype may have a worse response to capecitabine or fluorouracil as compared to patients with the HLA-G del/ATTTGTTCATGCCT or ATTTGTTCATGCCT/ATTTGTTCATGCCT genotypes. Other clinical and genetic factors may also influence response to capecitabine or fluorouracil in patients with colorectal cancer.", "drugs": [{"drugFromSource": "fluorouracil"}], "pgxCategory": "efficacy", "phenotypeText": "Colorectal Neoplasms", "genotypeId": "21_29830804_T_T,T", "variantRsId": "rs371194629", "variantFunctionalConsequenceId": "SO_0002073", "targetFromSourceId": "ENSG00000171189"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1444668808", "evidenceLevel": "3", "literature": ["11593098", "11910301"], "genotype": "ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC/ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC", "genotypeAnnotationText": "Hypertensive patients with the rs1799752 ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC/ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC genotype may have an increased response to irbesartan as compared to patients with the ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC/del or del/del genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to irbesartan.", "drugs": [{"drugFromSource": "irbesartan"}], "pgxCategory": "efficacy", "phenotypeText": "Hypertension", "phenotypeFromSourceId": "EFO_0000537", "genotypeId": "21_36146407_T_TATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC,TATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC", "variantRsId": "rs1799752", "variantFunctionalConsequenceId": "SO_0001587", "targetFromSourceId": "ENSG00000159231"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1444668808", "evidenceLevel": "3", "literature": ["11593098", "11910301"], "genotype": "ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC/del", "genotypeAnnotationText": "Hypertensive patients with the rs1799752 ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC/del genotype may have a decreased response to irbesartan as compared to patients with the ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC/ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to irbesartan.", "drugs": [{"drugFromSource": "irbesartan"}], "pgxCategory": "efficacy", "phenotypeText": "Hypertension", "phenotypeFromSourceId": "EFO_0000537", "genotypeId": "21_36146407_T_T,TATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC", "variantRsId": "rs1799752", "variantFunctionalConsequenceId": "SO_0001587", "targetFromSourceId": "ENSG00000159231"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1444668808", "evidenceLevel": "3", "literature": ["11593098", "11910301"], "genotype": "del/del", "genotypeAnnotationText": "Hypertensive patients with the rs1799752 del/del genotype may have a decreased response to irbesartan as compared to patients with the ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC/ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to irbesartan.", "drugs": [{"drugFromSource": "irbesartan"}], "pgxCategory": "efficacy", "phenotypeText": "Hypertension", "phenotypeFromSourceId": "EFO_0000537", "genotypeId": "21_36146407_T_T,T", "variantRsId": "rs1799752", "variantFunctionalConsequenceId": "SO_0002073", "targetFromSourceId": "ENSG00000159231"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1444668808", "evidenceLevel": "3", "literature": ["11593098", "11910301"], "genotype": "ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC/ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC", "genotypeAnnotationText": "Hypertensive patients with the rs1799752 ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC/ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC genotype may have an increased response to irbesartan as compared to patients with the ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC/del or del/del genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to irbesartan.", "drugs": [{"drugFromSource": "irbesartan"}], "pgxCategory": "efficacy", "phenotypeText": "Hypertrophy, Left Ventricular", "genotypeId": "21_36146407_T_TATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC,TATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC", "variantRsId": "rs1799752", "variantFunctionalConsequenceId": "SO_0001587", "targetFromSourceId": "ENSG00000159231"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1444668808", "evidenceLevel": "3", "literature": ["11593098", "11910301"], "genotype": "ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC/del", "genotypeAnnotationText": "Hypertensive patients with the rs1799752 ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC/del genotype may have a decreased response to irbesartan as compared to patients with the ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC/ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to irbesartan.", "drugs": [{"drugFromSource": "irbesartan"}], "pgxCategory": "efficacy", "phenotypeText": "Hypertrophy, Left Ventricular", "genotypeId": "21_36146407_T_T,TATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC", "variantRsId": "rs1799752", "variantFunctionalConsequenceId": "SO_0001587", "targetFromSourceId": "ENSG00000159231"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1444668808", "evidenceLevel": "3", "literature": ["11593098", "11910301"], "genotype": "del/del", "genotypeAnnotationText": "Hypertensive patients with the rs1799752 del/del genotype may have a decreased response to irbesartan as compared to patients with the ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC/ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to irbesartan.", "drugs": [{"drugFromSource": "irbesartan"}], "pgxCategory": "efficacy", "phenotypeText": "Hypertrophy, Left Ventricular", "genotypeId": "21_36146407_T_T,T", "variantRsId": "rs1799752", "variantFunctionalConsequenceId": "SO_0002073", "targetFromSourceId": "ENSG00000159231"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449566379", "evidenceLevel": "3", "literature": ["29925376"], "genotype": "AA", "genotypeAnnotationText": "Patients with the AA genotype and hypertension may have an increased response to hydrochlorothiazide treatment, as measured by decreases in systolic and diastolic blood pressure, as compared to patients with the AG or GG genotypes. Other genetic and clinical factors may also affect a patient's response to hydrochlorothiazide.", "drugs": [{"drugFromSource": "hydrochlorothiazide"}], "pgxCategory": "efficacy", "phenotypeText": "Hypertension", "phenotypeFromSourceId": "EFO_0000537", "genotypeId": "21_14286933_A_A,A", "variantRsId": "rs11065987"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449566379", "evidenceLevel": "3", "literature": ["29925376"], "genotype": "AA", "genotypeAnnotationText": "Patients with the AA genotype and hypertension may have an increased response to hydrochlorothiazide treatment, as measured by decreases in systolic and diastolic blood pressure, as compared to patients with the AG or GG genotypes. Other genetic and clinical factors may also affect a patient's response to hydrochlorothiazide.", "drugs": [{"drugFromSource": "hydrochlorothiazide"}], "pgxCategory": "metabolism/pk", "phenotypeText": "Hypertension", "phenotypeFromSourceId": "EFO_0000537", "genotypeId": "21_14286933_A_A,A", "variantRsId": "rs11065987"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449566379", "evidenceLevel": "3", "literature": ["29925376"], "genotype": "AG", "genotypeAnnotationText": "Patients with the AG genotype and hypertension may have an increased response to hydrochlorothiazide treatment, as measured by decreases in systolic and diastolic blood pressure, as compared to patients with the GG genotype, but a decreased response as compared to patients with the AA genotype. Other genetic and clinical factors may also affect a patient's response to hydrochlorothiazide.", "drugs": [{"drugFromSource": "hydrochlorothiazide"}], "pgxCategory": "efficacy", "phenotypeText": "Hypertension", "phenotypeFromSourceId": "EFO_0000537", "genotypeId": "21_14286933_A_A,G", "variantRsId": "rs11065987"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449566379", "evidenceLevel": "3", "literature": ["29925376"], "genotype": "AG", "genotypeAnnotationText": "Patients with the AG genotype and hypertension may have an increased response to hydrochlorothiazide treatment, as measured by decreases in systolic and diastolic blood pressure, as compared to patients with the GG genotype, but a decreased response as compared to patients with the AA genotype. Other genetic and clinical factors may also affect a patient's response to hydrochlorothiazide.", "drugs": [{"drugFromSource": "hydrochlorothiazide"}], "pgxCategory": "metabolism/pk", "phenotypeText": "Hypertension", "phenotypeFromSourceId": "EFO_0000537", "genotypeId": "21_14286933_A_A,G", "variantRsId": "rs11065987"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449566379", "evidenceLevel": "3", "literature": ["29925376"], "genotype": "GG", "genotypeAnnotationText": "Patients with the GG genotype and hypertension may have a decreased response to hydrochlorothiazide treatment, as measured by decreases in systolic and diastolic blood pressure, as compared to patients with the AA or AG genotypes. Other genetic and clinical factors may also affect a patient's response to hydrochlorothiazide.", "drugs": [{"drugFromSource": "hydrochlorothiazide"}], "pgxCategory": "efficacy", "phenotypeText": "Hypertension", "phenotypeFromSourceId": "EFO_0000537", "genotypeId": "21_14286933_A_G,G", "variantRsId": "rs11065987"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1449566379", "evidenceLevel": "3", "literature": ["29925376"], "genotype": "GG", "genotypeAnnotationText": "Patients with the GG genotype and hypertension may have a decreased response to hydrochlorothiazide treatment, as measured by decreases in systolic and diastolic blood pressure, as compared to patients with the AA or AG genotypes. Other genetic and clinical factors may also affect a patient's response to hydrochlorothiazide.", "drugs": [{"drugFromSource": "hydrochlorothiazide"}], "pgxCategory": "metabolism/pk", "phenotypeText": "Hypertension", "phenotypeFromSourceId": "EFO_0000537", "genotypeId": "21_14286933_A_G,G", "variantRsId": "rs11065987"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1451114960", "evidenceLevel": "3", "literature": ["19384296", "21919605", "20385995", "20165956", "20932673", "14522928", "15918040", "21167658", "20665215", "25232828", "16249645", "11913730", "28972045"], "genotype": "(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2", "genotypeAnnotationText": "Patients with the rs45445694 (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 or 2R/2R genotype may have an increased response or survival when treated with fluorouracil chemotherapy regimens as compared to patients with the 2R/3R or 3R/3R genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to fluorouracil chemotherapy.", "drugs": [{"drugFromSource": "fluorouracil"}], "pgxCategory": "efficacy", "phenotypeText": "overall survival", "phenotypeFromSourceId": "EFO_0000638", "variantRsId": "rs45445694"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1451114960", "evidenceLevel": "3", "literature": ["19384296", "21919605", "20385995", "20165956", "20932673", "14522928", "15918040", "21167658", "20665215", "25232828", "16249645", "11913730", "28972045"], "genotype": "(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2", "genotypeAnnotationText": "Patients with the rs45445694 (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 or 2R/2R genotype may have an increased response or survival when treated with fluorouracil chemotherapy regimens as compared to patients with the 2R/3R or 3R/3R genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to fluorouracil chemotherapy.", "drugs": [{"drugFromSource": "FOLFIRI"}], "pgxCategory": "efficacy", "phenotypeText": "overall survival", "phenotypeFromSourceId": "EFO_0000638", "variantRsId": "rs45445694"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1451114960", "evidenceLevel": "3", "literature": ["19384296", "21919605", "20385995", "20165956", "20932673", "14522928", "15918040", "21167658", "20665215", "25232828", "16249645", "11913730", "28972045"], "genotype": "(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2", "genotypeAnnotationText": "Patients with the rs45445694 (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 or 2R/2R genotype may have an increased response or survival when treated with fluorouracil chemotherapy regimens as compared to patients with the 2R/3R or 3R/3R genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to fluorouracil chemotherapy.", "drugs": [{"drugFromSource": "FOLFOX"}], "pgxCategory": "efficacy", "phenotypeText": "overall survival", "phenotypeFromSourceId": "EFO_0000638", "variantRsId": "rs45445694"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1451114960", "evidenceLevel": "3", "literature": ["19384296", "21919605", "20385995", "20165956", "20932673", "14522928", "15918040", "21167658", "20665215", "25232828", "16249645", "11913730", "28972045"], "genotype": "(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3", "genotypeAnnotationText": "Patients with the rs45445694 (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 or 2R/3R genotype may have an increased response or survival when treated with fluorouracil chemotherapy regimens as compared to patients with the 3R/3R genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to fluorouracil chemotherapy.", "drugs": [{"drugFromSource": "fluorouracil"}], "pgxCategory": "efficacy", "phenotypeText": "overall survival", "phenotypeFromSourceId": "EFO_0000638", "variantRsId": "rs45445694"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1451114960", "evidenceLevel": "3", "literature": ["19384296", "21919605", "20385995", "20165956", "20932673", "14522928", "15918040", "21167658", "20665215", "25232828", "16249645", "11913730", "28972045"], "genotype": "(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3", "genotypeAnnotationText": "Patients with the rs45445694 (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 or 2R/3R genotype may have an increased response or survival when treated with fluorouracil chemotherapy regimens as compared to patients with the 3R/3R genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to fluorouracil chemotherapy.", "drugs": [{"drugFromSource": "FOLFIRI"}], "pgxCategory": "efficacy", "phenotypeText": "overall survival", "phenotypeFromSourceId": "EFO_0000638", "variantRsId": "rs45445694"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1451114960", "evidenceLevel": "3", "literature": ["19384296", "21919605", "20385995", "20165956", "20932673", "14522928", "15918040", "21167658", "20665215", "25232828", "16249645", "11913730", "28972045"], "genotype": "(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3", "genotypeAnnotationText": "Patients with the rs45445694 (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 or 2R/3R genotype may have an increased response or survival when treated with fluorouracil chemotherapy regimens as compared to patients with the 3R/3R genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to fluorouracil chemotherapy.", "drugs": [{"drugFromSource": "FOLFOX"}], "pgxCategory": "efficacy", "phenotypeText": "overall survival", "phenotypeFromSourceId": "EFO_0000638", "variantRsId": "rs45445694"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1451114960", "evidenceLevel": "3", "literature": ["19384296", "21919605", "20385995", "20165956", "20932673", "14522928", "15918040", "21167658", "20665215", "25232828", "16249645", "11913730", "28972045"], "genotype": "(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3", "genotypeAnnotationText": "Patients with the rs45445694 (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 or 3R/3R genotype may have a decreased response or survival when treated with fluorouracil chemotherapy regimens as compared to patients with the 2R/2R or 2R/3R genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to fluorouracil chemotherapy.", "drugs": [{"drugFromSource": "fluorouracil"}], "pgxCategory": "efficacy", "phenotypeText": "overall survival", "phenotypeFromSourceId": "EFO_0000638", "variantRsId": "rs45445694"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1451114960", "evidenceLevel": "3", "literature": ["19384296", "21919605", "20385995", "20165956", "20932673", "14522928", "15918040", "21167658", "20665215", "25232828", "16249645", "11913730", "28972045"], "genotype": "(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3", "genotypeAnnotationText": "Patients with the rs45445694 (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 or 3R/3R genotype may have a decreased response or survival when treated with fluorouracil chemotherapy regimens as compared to patients with the 2R/2R or 2R/3R genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to fluorouracil chemotherapy.", "drugs": [{"drugFromSource": "FOLFIRI"}], "pgxCategory": "efficacy", "phenotypeText": "overall survival", "phenotypeFromSourceId": "EFO_0000638", "variantRsId": "rs45445694"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1451114960", "evidenceLevel": "3", "literature": ["19384296", "21919605", "20385995", "20165956", "20932673", "14522928", "15918040", "21167658", "20665215", "25232828", "16249645", "11913730", "28972045"], "genotype": "(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3", "genotypeAnnotationText": "Patients with the rs45445694 (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 or 3R/3R genotype may have a decreased response or survival when treated with fluorouracil chemotherapy regimens as compared to patients with the 2R/2R or 2R/3R genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to fluorouracil chemotherapy.", "drugs": [{"drugFromSource": "FOLFOX"}], "pgxCategory": "efficacy", "phenotypeText": "overall survival", "phenotypeFromSourceId": "EFO_0000638", "variantRsId": "rs45445694"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1451114960", "evidenceLevel": "3", "literature": ["19384296", "21919605", "20385995", "20165956", "20932673", "14522928", "15918040", "21167658", "20665215", "25232828", "16249645", "11913730", "28972045"], "genotype": "(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2", "genotypeAnnotationText": "Patients with the rs45445694 (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 or 2R/2R genotype may have an increased response or survival when treated with fluorouracil chemotherapy regimens as compared to patients with the 2R/3R or 3R/3R genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to fluorouracil chemotherapy.", "drugs": [{"drugFromSource": "fluorouracil"}], "pgxCategory": "efficacy", "phenotypeText": "progression-free survival", "variantRsId": "rs45445694"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1451114960", "evidenceLevel": "3", "literature": ["19384296", "21919605", "20385995", "20165956", "20932673", "14522928", "15918040", "21167658", "20665215", "25232828", "16249645", "11913730", "28972045"], "genotype": "(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2", "genotypeAnnotationText": "Patients with the rs45445694 (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 or 2R/2R genotype may have an increased response or survival when treated with fluorouracil chemotherapy regimens as compared to patients with the 2R/3R or 3R/3R genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to fluorouracil chemotherapy.", "drugs": [{"drugFromSource": "FOLFIRI"}], "pgxCategory": "efficacy", "phenotypeText": "progression-free survival", "variantRsId": "rs45445694"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1451114960", "evidenceLevel": "3", "literature": ["19384296", "21919605", "20385995", "20165956", "20932673", "14522928", "15918040", "21167658", "20665215", "25232828", "16249645", "11913730", "28972045"], "genotype": "(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2", "genotypeAnnotationText": "Patients with the rs45445694 (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 or 2R/2R genotype may have an increased response or survival when treated with fluorouracil chemotherapy regimens as compared to patients with the 2R/3R or 3R/3R genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to fluorouracil chemotherapy.", "drugs": [{"drugFromSource": "FOLFOX"}], "pgxCategory": "efficacy", "phenotypeText": "progression-free survival", "variantRsId": "rs45445694"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1451114960", "evidenceLevel": "3", "literature": ["19384296", "21919605", "20385995", "20165956", "20932673", "14522928", "15918040", "21167658", "20665215", "25232828", "16249645", "11913730", "28972045"], "genotype": "(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3", "genotypeAnnotationText": "Patients with the rs45445694 (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 or 2R/3R genotype may have an increased response or survival when treated with fluorouracil chemotherapy regimens as compared to patients with the 3R/3R genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to fluorouracil chemotherapy.", "drugs": [{"drugFromSource": "fluorouracil"}], "pgxCategory": "efficacy", "phenotypeText": "progression-free survival", "variantRsId": "rs45445694"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1451114960", "evidenceLevel": "3", "literature": ["19384296", "21919605", "20385995", "20165956", "20932673", "14522928", "15918040", "21167658", "20665215", "25232828", "16249645", "11913730", "28972045"], "genotype": "(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3", "genotypeAnnotationText": "Patients with the rs45445694 (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 or 2R/3R genotype may have an increased response or survival when treated with fluorouracil chemotherapy regimens as compared to patients with the 3R/3R genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to fluorouracil chemotherapy.", "drugs": [{"drugFromSource": "FOLFIRI"}], "pgxCategory": "efficacy", "phenotypeText": "progression-free survival", "variantRsId": "rs45445694"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1451114960", "evidenceLevel": "3", "literature": ["19384296", "21919605", "20385995", "20165956", "20932673", "14522928", "15918040", "21167658", "20665215", "25232828", "16249645", "11913730", "28972045"], "genotype": "(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3", "genotypeAnnotationText": "Patients with the rs45445694 (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 or 2R/3R genotype may have an increased response or survival when treated with fluorouracil chemotherapy regimens as compared to patients with the 3R/3R genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to fluorouracil chemotherapy.", "drugs": [{"drugFromSource": "FOLFOX"}], "pgxCategory": "efficacy", "phenotypeText": "progression-free survival", "variantRsId": "rs45445694"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1451114960", "evidenceLevel": "3", "literature": ["19384296", "21919605", "20385995", "20165956", "20932673", "14522928", "15918040", "21167658", "20665215", "25232828", "16249645", "11913730", "28972045"], "genotype": "(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3", "genotypeAnnotationText": "Patients with the rs45445694 (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 or 3R/3R genotype may have a decreased response or survival when treated with fluorouracil chemotherapy regimens as compared to patients with the 2R/2R or 2R/3R genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to fluorouracil chemotherapy.", "drugs": [{"drugFromSource": "fluorouracil"}], "pgxCategory": "efficacy", "phenotypeText": "progression-free survival", "variantRsId": "rs45445694"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1451114960", "evidenceLevel": "3", "literature": ["19384296", "21919605", "20385995", "20165956", "20932673", "14522928", "15918040", "21167658", "20665215", "25232828", "16249645", "11913730", "28972045"], "genotype": "(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3", "genotypeAnnotationText": "Patients with the rs45445694 (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 or 3R/3R genotype may have a decreased response or survival when treated with fluorouracil chemotherapy regimens as compared to patients with the 2R/2R or 2R/3R genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to fluorouracil chemotherapy.", "drugs": [{"drugFromSource": "FOLFIRI"}], "pgxCategory": "efficacy", "phenotypeText": "progression-free survival", "variantRsId": "rs45445694"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1451114960", "evidenceLevel": "3", "literature": ["19384296", "21919605", "20385995", "20165956", "20932673", "14522928", "15918040", "21167658", "20665215", "25232828", "16249645", "11913730", "28972045"], "genotype": "(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3", "genotypeAnnotationText": "Patients with the rs45445694 (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 or 3R/3R genotype may have a decreased response or survival when treated with fluorouracil chemotherapy regimens as compared to patients with the 2R/2R or 2R/3R genotype. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence response to fluorouracil chemotherapy.", "drugs": [{"drugFromSource": "FOLFOX"}], "pgxCategory": "efficacy", "phenotypeText": "progression-free survival", "variantRsId": "rs45445694"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1447979749", "evidenceLevel": "1A", "literature": ["29126871", "28606620", "27898234", "27898234", "25981758", "27805836", "27805836", "29327948", "29451946", "28325531", "27334259", "24973281", "24973281", "24973281", "27298017"], "genotype": "CTT/CTT", "genotypeAnnotationText": "Patients with cystic fibrosis and the rs113993960 CTT/CTT genotype (no copies of the CFTR F508del variant) have an unknown response to the combination drug ivacaftor/lumacaftor as this genotype is not an indication for ivacaftor/lumacaftor. Other genetic and clinical factors may also influence response to ivacaftor/lumacaftor.", "drugs": [{"drugFromSource": "ivacaftor"}, {"drugFromSource": "lumacaftor"}], "pgxCategory": "efficacy", "phenotypeText": "Cystic Fibrosis", "phenotypeFromSourceId": "MONDO_0009061", "genotypeId": "21_5010011_CCTT_CCTT,CCTT", "variantRsId": "rs113993960"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1447979749", "evidenceLevel": "1A", "literature": ["29126871", "28606620", "27898234", "27898234", "25981758", "27805836", "27805836", "29327948", "29451946", "28325531", "27334259", "24973281", "24973281", "24973281", "27298017"], "genotype": "CTT/del", "genotypeAnnotationText": "Patients with cystic fibrosis and the rs113993960 CTT/del genotype (one copy of the CFTR F508del variant) may experience a limited benefit from treatment with the combination drug of ivacaftor/lumacaftor, as shown by improvement in sweat chloride concentrations CFQ-R questionnaire scores when compared to treatment with placebo. However, ppFEV1, BMI or body weight did not show a significant improvement following ivacaftor/lumacaftor treatment. This genotype is not an indication for use of the combination drug of ivacaftor/lumacaftor according to the FDA-approved drug label for this drug combination. Other genetic and clinical factors may also influence response to ivacaftor/lumacaftor.", "drugs": [{"drugFromSource": "ivacaftor"}, {"drugFromSource": "lumacaftor"}], "pgxCategory": "efficacy", "phenotypeText": "Cystic Fibrosis", "phenotypeFromSourceId": "MONDO_0009061", "genotypeId": "21_5010011_CCTT_C,CCTT", "variantRsId": "rs113993960"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1447979749", "evidenceLevel": "1A", "literature": ["29126871", "28606620", "27898234", "27898234", "25981758", "27805836", "27805836", "29327948", "29451946", "28325531", "27334259", "24973281", "24973281", "24973281", "27298017"], "genotype": "del/del", "genotypeAnnotationText": "Patients with cystic fibrosis and the rs113993960 del/del genotype (two copies of the F508del variant) may benefit from treatment with the combination drug of ivacaftor/lumacaftor, as shown by improvement in sweat chloride concentrations and/or forced expiratory volume in 1 second (FEV1) when compared to treatment with placebo. This genotype is an indication for use of ivacaftor/lumacaftor according to the FDA-approved drug label for this drug combination. Other genetic and clinical factors may also influence response to ivacaftor/lumacaftor.", "drugs": [{"drugFromSource": "ivacaftor"}, {"drugFromSource": "lumacaftor"}], "pgxCategory": "efficacy", "phenotypeText": "Cystic Fibrosis", "phenotypeFromSourceId": "MONDO_0009061", "genotypeId": "21_5010011_CCTT_C,C", "variantRsId": "rs113993960"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1448427588", "evidenceLevel": "3", "literature": ["27168101"], "genotype": "non-null/non-null", "genotypeAnnotationText": "Patients with the non-null/non-null genotype may have a decreased risk for neutropenia when treated with clozapine as compared to patients with the null/null genotype. Other genetic and clinical factors may also influence neutropenia risk.", "drugs": [{"drugFromSource": "clozapine"}], "pgxCategory": "toxicity", "haplotypeId": "GSTT1 non-null/non-null", "targetFromSourceId": "ENSG00000277656"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1448427588", "evidenceLevel": "3", "literature": ["27168101"], "genotype": "null/non-null", "genotypeAnnotationText": "Patients with the null/non-null genotype may have a decreased risk for neutropenia when treated with clozapine as compared to patients with the null/null genotype. Other genetic and clinical factors may also influence neutropenia risk.", "drugs": [{"drugFromSource": "clozapine"}], "pgxCategory": "toxicity", "haplotypeId": "GSTT1 null/non-null", "targetFromSourceId": "ENSG00000277656"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1448427588", "evidenceLevel": "3", "literature": ["27168101"], "genotype": "null/null", "genotypeAnnotationText": "Patients with the null/null genotype may have an increased risk for neutropenia when treated with clozapine as compared to patients with the null/non-null or non-null/non-null genotype. Other genetic and clinical factors may also influence neutropenia risk.", "drugs": [{"drugFromSource": "clozapine"}], "pgxCategory": "toxicity", "haplotypeId": "GSTT1 null/null", "targetFromSourceId": "ENSG00000277656"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1448427588", "evidenceLevel": "3", "literature": ["27168101"], "genotype": "null", "genotypeAnnotationText": "Patients with the null/null genotype may have an increased risk for neutropenia when treated with clozapine as compared to patients with the null/non-null or non-null/non-null genotype. Other genetic and clinical factors may also influence neutropenia risk.", "drugs": [{"drugFromSource": "clozapine"}], "pgxCategory": "toxicity", "haplotypeId": "GSTT1 null", "haplotypeFromSourceId": "PA166048678", "targetFromSourceId": "ENSG00000277656"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "Drug Hypersensitivity", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000224608"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "Drug Hypersensitivity", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000223532"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "Drug Hypersensitivity", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000206450"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "Drug Hypersensitivity", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000232126"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "Drug Hypersensitivity", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000228964"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "Drug Hypersensitivity", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000234745"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "drug reaction with eosinophilia and systemic symptoms", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000224608"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "drug reaction with eosinophilia and systemic symptoms", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000223532"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "drug reaction with eosinophilia and systemic symptoms", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000206450"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "drug reaction with eosinophilia and systemic symptoms", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000232126"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "drug reaction with eosinophilia and systemic symptoms", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000228964"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "drug reaction with eosinophilia and systemic symptoms", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000234745"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "Epidermal Necrolysis, Toxic", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000224608"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "Epidermal Necrolysis, Toxic", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000223532"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "Epidermal Necrolysis, Toxic", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000206450"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "Epidermal Necrolysis, Toxic", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000232126"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "Epidermal Necrolysis, Toxic", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000228964"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "Epidermal Necrolysis, Toxic", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000234745"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "severe cutaneous adverse reactions", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000224608"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "severe cutaneous adverse reactions", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000223532"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "severe cutaneous adverse reactions", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000206450"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "severe cutaneous adverse reactions", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000232126"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "severe cutaneous adverse reactions", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000228964"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "severe cutaneous adverse reactions", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000234745"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "Stevens-Johnson Syndrome", "phenotypeFromSourceId": "EFO_0004276", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000224608"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "Stevens-Johnson Syndrome", "phenotypeFromSourceId": "EFO_0004276", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000223532"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "Stevens-Johnson Syndrome", "phenotypeFromSourceId": "EFO_0004276", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000206450"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "Stevens-Johnson Syndrome", "phenotypeFromSourceId": "EFO_0004276", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000232126"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "Stevens-Johnson Syndrome", "phenotypeFromSourceId": "EFO_0004276", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000228964"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "981419260", "evidenceLevel": "1A", "literature": ["21545408", "21393610", "21301380", "19696695", "19018717", "18192896", "15743917", "22909208", "22909208", "23669020", "23600531", "23280169", "22348415", "21906289", "17587850", "22017528", "19483528", "22901319", "21790926", "21912425", "24858023", "25115449", "19002350", "21393610", "25257159", "25327504", "26104483", "26632391", "26655481", "26937673", "26996548", "27486401", "25899558", "28509689", "28857441", "29392141", "30383575", "32433341", "25566896", "27835909"], "genotype": "*58:01", "genotypeAnnotationText": "Patients with one or two copies of the HLA-B*58:01 allele may have an increased risk of severe cutaneous adverse reactions, such as Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis, when treated with allopurinol as compared to patients with no HLA-B*58:01 alleles or negative for the HLA-B*58:01 test. However, conflicting evidence has been reported. Other genetic and clinical factors may also influence the risk of allopurinol-induced adverse reactions.", "directionality": "Presence", "drugs": [{"drugFromSource": "allopurinol"}], "pgxCategory": "toxicity", "phenotypeText": "Stevens-Johnson Syndrome", "phenotypeFromSourceId": "EFO_0004276", "haplotypeId": "HLA-B*58:01", "haplotypeFromSourceId": "PA165987831", "targetFromSourceId": "ENSG00000234745"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1183621000", "evidenceLevel": "1A", "literature": ["22190578", "22015451", "18561168", "16204390", "2019023", "2019023", "9369411", "12075750", "22573495", "17387701", "12942574", "23860572", "24750455", "25115783", "25988058", "26033222", "28370399", "29290749", "20196170", "23209099", "19654083", "23989394"], "genotype": "A- 202A_376G", "genotypeAnnotationText": "Patients with one X-chromosome and the A- 202A_376G allele who are treated with rasburicase may have an increased risk of methemoglobinemia and/or hemolysis as compared to patients with the reference B allele (non-deficient, class IV). Patients with two X-chromosomes and the A- 202A_376G allele in combination with another deficient class I-III allele who are treated with rasburicase may have an increased risk of methemoglobinemia and/or hemolysis as compared to patients with two copies of the reference B allele (non-deficient, class IV). Patients with two X-chromosomes and the A- 202A_376G allele in combination with a non-deficient allele who are treated with rasburicase have an unknown risk of methemoglobinemia and/or hemolysis as compared to patients with two copies of the reference B allele (non-deficient, class IV). Other genetic and clinical factors may also influence risk of drug-induced hemolysis.", "directionality": "III/Deficient", "drugs": [{"drugFromSource": "rasburicase"}], "pgxCategory": "toxicity", "phenotypeText": "Hemolysis", "phenotypeFromSourceId": "EFO_0009473", "haplotypeId": "G6PD A- 202A_376G", "haplotypeFromSourceId": "PA165947827", "targetFromSourceId": "ENSG00000160211"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1183621000", "evidenceLevel": "1A", "literature": ["22190578", "22015451", "18561168", "16204390", "2019023", "2019023", "9369411", "12075750", "22573495", "17387701", "12942574", "23860572", "24750455", "25115783", "25988058", "26033222", "28370399", "29290749", "20196170", "23209099", "19654083", "23989394"], "genotype": "B (reference)", "genotypeAnnotationText": "Patients with one X-chromosome and the reference B (reference) allele (non-deficient, class IV) who are treated with rasburicase may have a decreased risk of methemoglobinemia and/or hemolysis as compared to patients with a deficient class I-III allele. Patients with two X-chromosomes and two copies of the reference B allele (non-deficient, class IV) who are treated with rasburicase may have a decreased risk of methemoglobinemia and/or hemolysis as compared to patients with a deficient class I-III allele. Patients with two X-chromosomes, one copy of the reference B allele (non-deficient, class IV) and one deficient class I-III allele who are treated with rasburicase have an unknown risk of methemoglobinemia and/or hemolysis as compared to patients with two copies of the reference B allele (non-deficient, class IV). Other genetic and clinical factors may also influence risk of drug-induced hemolysis.", "directionality": "IV/Normal", "drugs": [{"drugFromSource": "rasburicase"}], "pgxCategory": "toxicity", "phenotypeText": "Hemolysis", "phenotypeFromSourceId": "EFO_0009473", "haplotypeId": "G6PD B (reference)", "haplotypeFromSourceId": "PA165947826", "targetFromSourceId": "ENSG00000160211"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1183621000", "evidenceLevel": "1A", "literature": ["22190578", "22015451", "18561168", "16204390", "2019023", "2019023", "9369411", "12075750", "22573495", "17387701", "12942574", "23860572", "24750455", "25115783", "25988058", "26033222", "28370399", "29290749", "20196170", "23209099", "19654083", "23989394"], "genotype": "Mediterranean, Dallas, Panama, Sassari, Cagliari, Birmingham", "genotypeAnnotationText": "Patients with one X-chromosome and the Mediterranean, Dallas, Panama, Sassari, Cagliari, Birmingham allele (rs5030868 allele A) who are treated with rasburicase may have an increased risk of methemoglobinemia and/or hemolysis as compared to patients with the reference B allele (non-deficient, class IV)(rs5030868 allele G). Patients with two X-chromosomes and the Mediterranean, Dallas, Panama' Sassari, Cagliari, Birmingham variant (rs5030868 allele A) in combination with another deficient class I-III allele who are treated with rasburicase may have an increased risk of methemoglobinemia and/or hemolysis as compared to patients with two copies of the reference B allele (non-deficient, class IV)(rs5030868 allele G). Patients with two X-chromosomes and the Mediterranean, Dallas, Panama' Sassari, Cagliari, Birmingham variant (rs5030868 allele A) in combination with a non-deficient allele who are treated with rasburicase have an unknown risk of methemoglobinemia and/or hemolysis as compared to patients with two copies of the reference B allele (non-deficient, class IV). Other genetic and clinical factors may also influence risk of drug-induced hemolysis.", "directionality": "II/Deficient", "drugs": [{"drugFromSource": "rasburicase"}], "pgxCategory": "toxicity", "phenotypeText": "Hemolysis", "phenotypeFromSourceId": "EFO_0009473", "haplotypeId": "G6PD Mediterranean, Dallas, Panama, Sassari, Cagliari, Birmingham", "haplotypeFromSourceId": "PA166121127", "targetFromSourceId": "ENSG00000160211"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1183621000", "evidenceLevel": "1A", "literature": ["22190578", "22015451", "18561168", "16204390", "2019023", "2019023", "9369411", "12075750", "22573495", "17387701", "12942574", "23860572", "24750455", "25115783", "25988058", "26033222", "28370399", "29290749", "20196170", "23209099", "19654083", "23989394"], "genotype": "A- 202A_376G", "genotypeAnnotationText": "Patients with one X-chromosome and the A- 202A_376G allele who are treated with rasburicase may have an increased risk of methemoglobinemia and/or hemolysis as compared to patients with the reference B allele (non-deficient, class IV). Patients with two X-chromosomes and the A- 202A_376G allele in combination with another deficient class I-III allele who are treated with rasburicase may have an increased risk of methemoglobinemia and/or hemolysis as compared to patients with two copies of the reference B allele (non-deficient, class IV). Patients with two X-chromosomes and the A- 202A_376G allele in combination with a non-deficient allele who are treated with rasburicase have an unknown risk of methemoglobinemia and/or hemolysis as compared to patients with two copies of the reference B allele (non-deficient, class IV). Other genetic and clinical factors may also influence risk of drug-induced hemolysis.", "directionality": "III/Deficient", "drugs": [{"drugFromSource": "rasburicase"}], "pgxCategory": "toxicity", "phenotypeText": "Methemoglobinemia", "phenotypeFromSourceId": "MONDO_0001117", "haplotypeId": "G6PD A- 202A_376G", "haplotypeFromSourceId": "PA165947827", "targetFromSourceId": "ENSG00000160211"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1183621000", "evidenceLevel": "1A", "literature": ["22190578", "22015451", "18561168", "16204390", "2019023", "2019023", "9369411", "12075750", "22573495", "17387701", "12942574", "23860572", "24750455", "25115783", "25988058", "26033222", "28370399", "29290749", "20196170", "23209099", "19654083", "23989394"], "genotype": "B (reference)", "genotypeAnnotationText": "Patients with one X-chromosome and the reference B (reference) allele (non-deficient, class IV) who are treated with rasburicase may have a decreased risk of methemoglobinemia and/or hemolysis as compared to patients with a deficient class I-III allele. Patients with two X-chromosomes and two copies of the reference B allele (non-deficient, class IV) who are treated with rasburicase may have a decreased risk of methemoglobinemia and/or hemolysis as compared to patients with a deficient class I-III allele. Patients with two X-chromosomes, one copy of the reference B allele (non-deficient, class IV) and one deficient class I-III allele who are treated with rasburicase have an unknown risk of methemoglobinemia and/or hemolysis as compared to patients with two copies of the reference B allele (non-deficient, class IV). Other genetic and clinical factors may also influence risk of drug-induced hemolysis.", "directionality": "IV/Normal", "drugs": [{"drugFromSource": "rasburicase"}], "pgxCategory": "toxicity", "phenotypeText": "Methemoglobinemia", "phenotypeFromSourceId": "MONDO_0001117", "haplotypeId": "G6PD B (reference)", "haplotypeFromSourceId": "PA165947826", "targetFromSourceId": "ENSG00000160211"}
{"datasourceId": "pharmgkb", "datasourceVersion": "2023-03-23", "datatypeId": "clinical_annotation", "studyId": "1183621000", "evidenceLevel": "1A", "literature": ["22190578", "22015451", "18561168", "16204390", "2019023", "2019023", "9369411", "12075750", "22573495", "17387701", "12942574", "23860572", "24750455", "25115783", "25988058", "26033222", "28370399", "29290749", "20196170", "23209099", "19654083", "23989394"], "genotype": "Mediterranean, Dallas, Panama, Sassari, Cagliari, Birmingham", "genotypeAnnotationText": "Patients with one X-chromosome and the Mediterranean, Dallas, Panama, Sassari, Cagliari, Birmingham allele (rs5030868 allele A) who are treated with rasburicase may have an increased risk of methemoglobinemia and/or hemolysis as compared to patients with the reference B allele (non-deficient, class IV)(rs5030868 allele G). Patients with two X-chromosomes and the Mediterranean, Dallas, Panama' Sassari, Cagliari, Birmingham variant (rs5030868 allele A) in combination with another deficient class I-III allele who are treated with rasburicase may have an increased risk of methemoglobinemia and/or hemolysis as compared to patients with two copies of the reference B allele (non-deficient, class IV)(rs5030868 allele G). Patients with two X-chromosomes and the Mediterranean, Dallas, Panama' Sassari, Cagliari, Birmingham variant (rs5030868 allele A) in combination with a non-deficient allele who are treated with rasburicase have an unknown risk of methemoglobinemia and/or hemolysis as compared to patients with two copies of the reference B allele (non-deficient, class IV). Other genetic and clinical factors may also influence risk of drug-induced hemolysis.", "directionality": "II/Deficient", "drugs": [{"drugFromSource": "rasburicase"}], "pgxCategory": "toxicity", "phenotypeText": "Methemoglobinemia", "phenotypeFromSourceId": "MONDO_0001117", "haplotypeId": "G6PD Mediterranean, Dallas, Panama, Sassari, Cagliari, Birmingham", "haplotypeFromSourceId": "PA166121127", "targetFromSourceId": "ENSG00000160211"}